Linkage mapping of chicken ovoinhibitor and ovomucoid genes to chromosome 13.
نویسندگان
چکیده
DogBAC canine BAC library (http://www.dogmap.ch/) was polymerase chain reaction (PCR)-screened. Primers were designed using canine mRNA sequence GenBank accession no. U62093 (primer UP: GACTGAGTACAAACTGGTGG and primer LO: GGGCCTCACCTCTATGGTG). The PCR conditions were established on canine blood genomic DNA, the corresponding PCR product cloned and verified by sequencing. The positive BAC clone (DogBAC library ID S050P24H09) was verified by PCR and sequencing.
منابع مشابه
Tiie Journal of Biological Cheniistry
Studies of the comparative properties of proteins and enzymes from closely related species are receiving increasing attention as an approach to understanding the relationships betwcen molecular structures and functions (1). Outstanding examples of these are the studies on the hemoglobins by Pauling et al. (2) and the studies on ribonucleases by Rnfinsen et al. (3). The purpose of this approach ...
متن کاملQTL mapping of heading date and plant height in Barley cross “Azumamugi”דKanto Nakate Gold
To identify quantitative trait loci (QTLs) controlling heading date and plant height, ninety nine F13 recombinant inbred lines (RILs) derived from barley cultivars Azumamugi × Kanto Nakate Gold cross were evaluated. The field trails were conducted at randomized complete block design with two and three replications in 2004 and 2005, respectively. Significant differences and transgrassive segrega...
متن کاملIdentification of major and minor genes associated with heading date in an indica × indica cross of rice (Oryza Sativa L.)
In this study, quantitative trait loci (QTLs) controlling rice heading date were detected in a F2:3 population derived from a cross between an indica rice variety, Tarom Mahalli, with early heading date, and an indica variety, Khazar, with late heading date. SSR linkage map was constructed using 74 polymorphic markers and 192 F2 individuals and covered a total of 1231.50 cM of rice genome. QTL ...
متن کاملIsolation and characterization of the chicken ovomucoid gene.
The chicken ovomucoid gene has been isolated by screening a chicken DNA library with a plasmid containing ovomucoid mRNA sequences. Twelve recombinant phages carrying ovomucoid mRNA sequences were isolated. Two of them, extending farthest into the 5' and 3' direction respectively, were characterized by restriction mapping and Southern hybridization as well as by electron microscopic analysis of...
متن کاملLinkage of Parkinson’s disease in two very early onset siblings to a locus on chromosome 1
Parkinson’s disease (PD) is a prevalent neurodegenerative disease that usually affects individuals over 50 years of age. Age at onset in a small subset of PD cases is considerably lower, and these are considered early-onset PD (EOPD) patients. Most PD cases appear sporadic, but approximately 15% are familial, and some of the familial cases exhibit Mendelian inheritance. Genetic analysis of fami...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Animal genetics
دوره 35 4 شماره
صفحات -
تاریخ انتشار 2004